0
You visited us 0 times! Enjoying our articles? Unlock Full Access!
Question

Choose the correct answer from the alternatives given :
Amino acids which are specified by single codons are
  1. Phenylalanine and arginine
  2. Valine and proline
  3. Tryptophan and methionine
  4. Methionine and arginine

A
Phenylalanine and arginine
B
Tryptophan and methionine
C
Methionine and arginine
D
Valine and proline
Solution
Verified by Toppr

Since there are 64 triplet codons and only 20 amino acids, the incorporation of some amino acids must be influenced by more than one codon. Only tryptophan (UGG) and methionine (AUG) are specified by single codons. All other amino acids are specified by two (e.g., phenylalanine UUU, UUC) to six (e.g., arginine CGU, CGC, CGA, CGG, AGA, AGG) codons. The latter are called degenerate or redundant codons. In degenerate codons, generally, the first two nitrogen bases are similar while the third one is different. As the third nitrogen base has no effect on coding, the same is called wobble position.
So, the correct answer is 'Tryptophan and methionine'.

Was this answer helpful?
2
Similar Questions
Q1
Choose the correct answer from the alternatives given :
Amino acids which are specified by single codons are
View Solution
Q2
Which of the following pair of amino acids is specified by a single codon?
View Solution
Q3

The amino acid constituent of a protein is given: Methionine, Valine, Tyrosine, Arginine, Threonine, Stop codon. Choose the correct DNA sequence from below which codes for it.


View Solution
Q4
Choose the correct answer from the alternatives given :
Direction : Read the sequence of nucleotides in the given segment of mRNA and the respective amino acid sequence in the polypeptide chain to answer the Q. nos. 65 and 66.
mRNA AUGUUUAUGCCUGUUUCUUAA
Polypeptide Met-Phe-Met-Pro-Val-Ser
Which codons respectively code for proline and valine amino acids in the given polypeptide chain, respectively?
928580_3828e3aba2f54c4885ec871077cd91e1.png
View Solution
Q5
Choose the correct answer from the alternatives given:
The amino acids we cannot synthesize are called _____ and we______
View Solution